Tema 5 Ácidos nucléicos



Descargar 115.96 Kb.
Fecha de conversión05.12.2017
Tamaño115.96 Kb.

Biología 2º Bachiller


TEMA 6 ÁCIDOS NUCLÉICOS


  1. ÁCIDOS NUCLEICOS

    1. CONCEPTO.

    2. FUNCIONES




  1. LOS NUCLEÓTIDOS: COMPONENTES

    1. LAS BASES NITROGENADAS

    2. EL AZÚCAR (GLÚCIDO)

    3. LOS NUCLEÓSIDOS

    4. ESTRUCTURA DE LOS NUCLEÓTIDOS

    5. NUCLEÓTIDOS O DERIVADOS DE NUCLEÓTIDOS DE INTERÉS BIOLÓGICO.

    6. LOS POLINUCLEÓTIDOS




  1. NUCLEOSIDOS Y NUCLEOTIDOS.

    1. ATP

      1. ESTRUCTURA

      2. FUNCIÓN

    2. ADN

      1. COMPOSICIÓN QUIMICA

      2. LOCALIZACION

      3. ESTRUCTURA ( MODELO DE WATSON Y CRICK)

    3. ARN

      1. COMPOSICIÓN QUIMICA

      2. LOCALIZACION

      3. TIPOS Y FUNCIONES DE CADA UNO DE ELLOS

      4. FUNCIONES DE LOS ÁCIDOS NUCLEICOS RIBONUCLEICOS

    4. ADN Y ARN: DIFERENCIAS A NIVEL QUÍMICO



  1. ÁCIDOS NUCLEICOS.




    1. CONCEPTO

Químicamente, los ácidos nucleicos son polímeros constituidos por la unión mediante enlaces químicos de unidades menores llamadas nucleótidos. Los ácidos nucleicos son compuestos de elevado peso molecular, esto es, son macromoléculas.


    1. FUNCIONES.

Los ácidos nucleicos, llamados así porque en un principio fueron localizados en el núcleo celular, son las moléculas de la herencia y por lo tanto van a participar en los mecanismos mediante los cuales la información genética se almacena, replica y transcribe. Ésta no va a ser su única función. Determinados derivados de estas sustancias: los nucleótidos, van a tener otras funciones biológicas, entre las que pueden destacarse, como ejemplo, la de servir de intermediarios en las transferencias de energía en las células (ATP, ADP y otros) o en las transferencias de electrones (NAD+ , NADP+ , FAD, etc.).


  1. LOS NUCLEÓTIDOS: COMPONENTES.

Los nucleótidos están formados por: una base nitrogenada (BN), un azúcar (A) y ácido fosfórico (P); unidos en el siguiente orden: PABN


    1. LAS BASES NITROGENADAS.

Son sustancias derivadas de dos compuestos químicos: la purina y la pirimidina. Las que derivan de la purina son las bases púricas. Las que derivan de la pirimidina se llaman pirimidínicas.

En los nucleótidos vamos a encontrar, normalmente, dos bases púricas: la adenina (A) y la guanina (G). Tres son las bases pirimidínicas presentes en los ácidos nucleicos: la citosina (C), la timina (T) y el uracilo (U).




En ciertos casos, aunque esto pasa muy raramente, pueden encontrarse en los ácidos nucleicos otras bases diferentes de estas cinco, por lo general derivados metilados de ellas.




    1. EL AZÚCAR (GLÚCIDO).

El azúcar que interviene en los nucleótidos puede ser o la ribosa (R) o la desoxirribosa (dR). Ambas son aldopentosas y las encontraremos en los nucleótidos como ß furanosas.

Conviene destacar que la única diferencia entre ambas está en que en el carbono 2 de la desoxirribosa hay un hidrógeno (-H) en lugar del grupo alcohol (-OH).



    1. LOS NUCLEÓSIDOS

El azúcar y la base nitrogenada se unen entre sí como se indica en las figuras formando un nucleósido. El enlace se forma entre el carbono anomérico del azúcar y uno de los nitrógenos de la base nitrogenada, en concreto, el indicado en la figura.

En la unión se forma una molécula de agua. Este enlace recibe el nombre de enlace N-glicosídico.


    1. ESTRUCTURA DE LOS NUCLEÓTIDOS.

Los nucleótidos son los monómeros que constituyen los ácidos nucléicos. Se forman cuando se unen el ácido fosfórico y un nucleósido. Es una unión fosfoéster entre un OH del ácido fosfórico y el OH situado en el carbono 5 del azúcar, con formación de una molécula de agua. Según el azúcar sea la ribosa o la desoxirribosa, tendremos ribonucleótidos o desoxirribonucleótidos. La timina nunca forma parte de los ribonucleótidos y el uracilo no forma parte de los desoxirribonucleótidos.


    1. NUCLEÓTIDOS O DERIVADOS DE NUCLEÓTIDOS DE INTERÉS BIOLÓGICO.

Algunos nucleótidos cumplen funciones por sí mismos. Así, por ejemplo:




      1. Nucleótidos que intervienen en las transferencias de energía: Se trata de moléculas que captan o desprenden energía al transformarse unas en otras. Así, el ATP desprende energía cuando se hidroliza, transformándose en ADP y fosfato inorgánico (Pi). Por el contrario, el ADP almacena energía cuando reacciona con el fosfato inorgánico y se transforma en ATP y agua. De esta forma se transporta energía (unas 7 kilocalorías por mol de ADP/ATP) de aquellas reacciones en las que se desprende (exergónicas) a aquellas en las que se necesita (endergónicas).


Ejemplos de nucleótidos transportadores de energía:
- AMP (adenosina-5'-monofosfato) A-R-P

- ADP (adenosina-5'-difosfato) A-R-P-P

- ATP (adenosina-5'-trifosfato) A-R-P-P-P

- GDP (guanosidina-5'-difosfato) G-R-P-P

- GTP (guanosidina-5'-trifosfato) G-R-P-P-P


      1. Nucleótidos que intervienen en los procesos de óxido-reducción. Estas moléculas captan electrones de moléculas a las que oxidan y los ceden a otras moléculas a las que a su vez reducen. Así, el NAD+ puede captar 2e- transformándose en su forma reducida, el NADH, y éste puede ceder dos electrones a otras sustancias, reduciéndolas y volviéndose a transformar a su forma oxidada, el NAD+. Así, se transportan electrones de aquellas reacciones en las que se desprende a aquellas en las que se necesitan.


Ejemplos de nucleótidos transportadores de electrones:

- NAD+ /NADH (Nicotinamida-adenina-dinucleótido) oxidado y reducido, respectivamente.

- NADP+ /NADPH (Nicotinamida-adenina-dinucleótido-fosfato), oxidado y reducido.

- FAD/FADH2 (Flavina-adenina-dinucleótido), oxidado y reducido.


      1. Nucleótidos reguladores de procesos metabólicos. Algunos nucleótidos cumplen funciones especiales como reguladores de procesos metabólicos, por ejemplo el AMPc (AMP cíclico o adenosina-3',5'-monofosfato), en el que dos OH del fosfato esterifican los OH en posiciones 3 y 5 de la ribosa formando un ciclo. Este compuesto químico actúa en las células como intermediario de muchas hormonas.




    1. LOS POLINUCLEÓTIDOS.

Dos nucleótidos van a poder unirse entre sí mediante un enlace ésterfosfato (fosfoéster). Este enlace se forma entre un OH del ácido fosfórico de un nucleótido y el OH (hidroxilo) del carbono número 3 del azúcar del otro nucleótido con formación de una molécula de agua. La unión de otros nucleótidos dará lugar a un polinucleótido.

Es de destacar que en toda cadena de polinucleótidos el nucleótido de uno de los extremos tendrá libre el OH del azúcar en posición 3, éste será el extremo 3' de la cadena. El ácido fosfórico del nucleótido que se encuentre en el extremo opuesto también estará libre, éste será el extremo 5'. Esto marca un sentido en la cadena de polinucleótidos.

Toda cadena podrá considerarse bien en sentido 3'5' o en sentido 5' 3' y así habrá que indicarlo.



http://campus.usal.es/~dbbm/modmol/modmol06/index06.html


  1. NUCLEÓSIDOS Y NUCLEÓTIDOS.

    1. ATP

      1. ESTRUCTURA.

El trifosfato de adenosina (ATP) o adenosín trifosfato es una molécula que consta de una purina (adenina), un azúcar (ribosa), y tres grupos fosfato. Es una molécula que se encuentra en todos los seres vivos y constituye la fuente principal de energía utilizable por las células para realizar sus actividades. Gran cantidad de energía para las funciones biológicas se almacena en los enlaces de alta energía que unen los grupos fosfato, y se liberan cuando uno o dos de los fosfatos se separan de las moléculas de ATP. El compuesto resultante de la pérdida de un fosfato se llama difosfato de adenosina, adenosín difosfato o ADP; si se pierden dos se llama monofosfato de adenosina, adenosín monofosfato o AMP, respectivamente.


      1. FUNCIÓN.

Impulsa reacciones transmitiendo grupos fosfato. Si el aceptor fuera el agua, la reacción de hidrólisis sería:

ATP + H2O  ADP + Pi

ATP + 2 H2O  AMP + Pi + pirofosfato

Función del ATP en el metabolismo.



  • Reacciones acopladas.

  • Reacciones de transferencia de fosfatos. Concepto de potencial de transferencia de fosfato.

  • Concepto de carga energética.

El ATP se origina por el metabolismo de los alimentos (glucólisis - respiración celular) en las mitocondrias. El ATP se comporta como una coenzima, ya que su función de intercambio de energía y la función catalítica (trabajo de estimulación) de las enzimas están íntimamente relacionadas. Con la liberación de un grupo fosfato se obtiene siete kilocalorías de energía disponible para el trabajo y la molécula de ATP se convierte en ADP (difosfato de adenosina). La mayoría de las reacciones celulares que consumen energía están potenciadas por la conversión de ATP a ADP, incluso la transmisión de las señales nerviosas, el movimiento de los músculos, la síntesis de proteínas y la división de la célula. Por lo general, el ADP recupera con rapidez el fosfato a través de la reacción del citocromo, una proteína que se sintetiza utilizando la energía aportada por los alimentos.

En las células del músculo y del cerebro de los vertebrados, el exceso de ATP puede unirse a la creatina, proporcionando un depósito de energía de reserva.



La liberación de dos grupos fosfatos del ATP por la enzima adenilato ciclasa forma AMP (monofosfato de adenosina), un nucleótido que forma parte de los ácidos nucleicos o el material del ADN. Esta enzima es importante en muchas de las reacciones del organismo. Una forma de AMP llamada AMP cíclico originado por la acción de esta participa en la actividad de muchas hormonas, como la adrenalina y la ACTH.



Las plantas producen ATP utilizando directamente la energía solar en un proceso denominado fotosíntesis.



    1. ADN

      1. COMPOSICIÓN QUIMICA.

Concepto: Químicamente son polinucleótidos constituidos por d-AMP, d-GMP, d-CMP y d-TMP. Los nucleótidos del ADN no tienen ni uracilo, ni ribosa,

Características: Los ADN celulares tienen una elevada masa molecular, muchos millones de daltons. Así, por ejemplo: el genoma humano está formado por 3x109 pares de nucleótidos. Esto hace que sean moléculas de una gran longitud; por ejemplo: 1,7 µm en el caso del virus de la poliomielitis y 2,36 m si sumamos todo el ADN de todos los cromosomas de una célula humana. El ADN fue aislado por primera vez en 1869, pero hasta 1950 no se empezó a conocer su estructura. Se encuentra en el núcleo de las células eucariotas asociado a histonas y otras proteínas formando la cromatina, sustancia que constituye los cromosomas y a partir de la cual se transcribe la información genética. También hay ADN en ciertos orgánulos celulares (por ejemplo: plastos y mitocondrias).


      1. LOCALIZACION.

El ADN se encuentra en el núcleo de las células eucariotas y también se encuentra en mitocondrias, cloroplastos y centriolos. En el genoma (conjunto integral y secuenciado del ADN) humano se estima que hay aproximadamente 50.000 ó más genes. Los genes son trozos funcionales de ADN compuestos a su vez de 1.000 hasta 200.000 unidades c/u llamadas nucleótidos.

En las células procarióticas se encuentra en el citoplasma, en la denominada zona nuclear.




      1. ESTRUCTURA (MODELO DE WATSON Y CRICK).

Se pueden distinguir 3 niveles estructurales:




  • Estructura primaria: La secuencia de los nucleótidos.

  • Estructura secundaria: La doble hélice.

  • Estructura terciaria: Collar de perlas, estructura cristalina, ADN superenrollado.

En las células eucariotas, a partir de la estructura 3, se dan otros niveles de empaquetamiento de orden superior.




http://www.nature.com/nature/dna50/watsoncrick.pdf
ESTRUCTURA PRIMARIA DEL ADN.

Es la secuencia de nucleótidos de una cadena o hebra. Es decir, la estructura primaria del ADN viene determinada por el orden de los nucleótidos en la hebra o cadena de la molécula. Para indicar la secuencia de una cadena de ADN es suficiente con los nombres de las bases o su inicial (A, T, C, G) en su orden correcto y los extremos 5' y 3' de la cadena nucleotídica.


Así, por ejemplo:
5'ACGTTTAACGACAAGGACAAGTATTAA3'

La posibilidad de combinar cuatro nucleótidos diferentes y la gran longitud que pueden tener las cadenas polinucleotídicas, hacen que pueda haber un elevado número de polinucleótidos posibles, lo que determina que el ADN pueda contener el mensaje biológico o información genética. Y explica la diversidad del mensaje genético de todos los seres vivos.



ESTRUCTURA SECUNDARIA DEL ADN.

Datos preliminares:




  1. A finales de los años 40 Erwin CHARGAFF y sus colaboradores estudiaron los componentes del ADN y emitieron los siguientes resultados: La concentración de bases varía de una especie a otra. El porcentaje de A, G, C y T es el mismo en los individuos de la misma especie y no por esto el mensaje es el mismo. Tejidos diferentes de la misma especie tienen la misma composición en bases. La composición en bases del ADN de una misma especie no varía con la edad del organismo ni con su estado nutricional ni con las variaciones ambientales. Las densidades y viscosidades corresponden a la existencia de enlaces de hidrógeno entre los grupos NH y los grupos CO. La concentración de Adenina es igual a la de Timina, y la de Citosina a la de Guanina. Las dos primeras establecen dos puentes de hidrógeno entre ellas, y las últimas tres puentes. La cantidad de purinas es igual a la cantidad de pirimidinas.




  1. Por medio del método analítico de difracción de rayos X, FRANKLIN y WILKINS observaron una estructura fibrilar de 20 Å (Amstrongs) de diámetro con repeticiones cada 3,4 Å y una mayor cada 34 Å.




  1. WATSON y CRICK postularon en 1953 un modelo tridimensional para la estructura del ADN que estaba de acuerdo con todos los datos disponibles anteriores: el modelo de doble hélice. Este modelo, además de explicar cómo era el ADN, sugería los mecanismos que explicaban su función biológica y la forma como se replicaba. Según el modelo de la doble hélice de WATSON y CRICK:




    1. El ADN estaría constituido por dos cadenas o hebras de polinucleótidos enrolladas helicoidalmente en sentido dextrógiro sobre un mismo eje formando una doble hélice.

    2. Ambas cadenas serían antiparalelas, una iría en sentido 3'5' y la otra en sentido inverso, 5' 3'.

    3. Los grupos fosfato estarían hacia el exterior y de este modo sus cargas negativas interaccionarían con los cationes presentes en el nucleoplasma dando más estabilidad a la molécula.

    4. Las bases nitrogenadas estarían hacia el interior de la hélice con sus planos paralelos entre sí y las bases de cada una de las hélices estarían apareadas con las de la otra asociándose mediante puentes de hidrógeno.

    5. El apareamiento se realizaría únicamente entre la adenina y la timina, por una parte, y la guanina y la citosina. Por lo tanto, la estructura primaria de una cadena estaría determinada por la de la otra, ambas cadenas serían complementarias.

La complementariedad de las cadenas sugiere el mecanismo por el cual el ADN se copia -se replica- para ser trasferido a las células hijas. Ambas cadenas o hebras se pueden separar parcialmente y servir de molde para la síntesis de una nueva cadena complementaria (síntesis semiconservativa).

El modelo de la Doble Hélice propuesto por Watson y Crick está basado en estudios del ADN en disolución (hidratado). La denominada forma B ó ADN-B tiene un mayor interés biológico ya que es la que presenta el ADN en interacción con las proteínas nucleares. Además de la forma B, existen otras estructuras posibles que puede presentar el ADN. Algunas de estas alternativas son las siguientes:



  • ADN-B: ADN en disolución, 92% de humedad relativa, se encuentra en soluciones con baja fuerza iónica se corresponde con el modelo de la Doble Hélice. 

  • ADN-A: ADN con 75% de humedad, requiere Na, K o Cs como contraiones, presenta 11 pares de bases por giro completo y 23 Å de diámetro. Es interesante por presentar una estructura parecida a la de los híbridos ADN-ARN y a las regiones de autoapareamiento ARN-ARN.

  • ADN-C: ADN con 66% de humedad, se obtiene en presencia de iones Li, muestra 9+1/3 pares de bases por giro completo y 19 Å de diámetro.

  • ADN-Z: doble hélice sinistrorsa (enrollamiento a izquierdas), 12 pares de bases por giro completo, 18 Å de diámetro, se observa en segmentos de ADN con secuencia alternante de bases púricas y pirimidínicas (GCGCGC), debido a la conformación alternante de los residuos azúcar-fosfato sigue un curso en zig-zag. Requiere una concentración de cationes superior a la del ADN-B, y teniendo en cuenta que las proteínas que interaccionan con el ADN tienen gran cantidad de residuos básicos sería posible que algunas convirtieran segmentos de ADN-B en ADN-Z. Las posiciones N7 y C8 de la Guanina son más accesibles.





ADN-A

ADN-B

ADN-Z

ADN-A

ADN-Z

ADN-B



PROPIEDADES DE LA ESTRUCTURA SECUNDARIA DEL ADN

DESNATURALIZACIÓN


Si una disolución de ADN se calienta suficientemente ambas cadenas se separan, pues se rompen los enlaces de hidrógeno que unen las bases, y el ADN se desnaturaliza. La temperatura de desnaturalización depende de la proporción de bases. A mayor proporción de C-G, mayor temperatura de desnaturalización, pues la citosina y la guanina establecen tres puentes de hidrógeno, mientras que la adenina y la timina sólo dos y, por lo tanto, a mayor proporción de C-G, más puentes de hidrógeno unirán ambas cadenas. La desnaturalización se produce también variando el pH o a concentraciones salinas elevadas. Si se restablecen las condiciones, el ADN se renaturaliza y ambas cadenas se unen de nuevo.


ESTRUCTURA TERCIARIA DEL ADN EN LAS CÉLULAS EUCARIOTAS.

Las grandes moléculas de ADN de las células eucariotas están muy empaquetadas ocupando así menos espacio en el núcleo celular y además como mecanismo para preservar su transcripción.

Como hemos visto, en las células eucariotas el ADN se encuentra en el núcleo asociado a ciertas proteínas: nucleoproteínas, formando la cromatina. En la cromatina, la doble hélice de ADN se enrolla alrededor de unas moléculas proteicas globulares, las histonas, formando los nucleosomas. Cada nucleosoma contiene 8 histonas y la doble hélice de ADN da dos vueltas a su alrededor (200 pares de bases). El conjunto, si no está más empaquetado aún, forma una estructura arrosariada llamada collar de perlas. Ahora bien, los nucleosomas pueden empaquetarse formando fibras de un grosor de 30 nm (fibra de 30 nm). Según el modelo del solenoide las fibras se forman al enrollarse seis nucleosomas por vuelta alrededor de un eje formado por las histonas H1.
NIVELES SUPERIORES DE EMPAQUETAMIENTO
Los siguientes niveles de empaquetamiento no están aún aclarados del todo pero, parece ser, que cada fibra se volvería a enrollar formando un bucle (cada bucle tendría 50 millones de pares de bases), seis bucles se empaquetarían asociándose a un " esqueleto nuclear" produciéndose un rosetón, 30 rosetones formarían una espiral y 20 espirales formarían una cromátida.

Todo ello produciría un gran acortamiento de las largas cadenas de ADN.

En los espermatozoides el ADN se encuentra aún mucho más empaquetado, se dice que tiene " estructura cristalina".

Los ADN de las bacterias, virus, mitocondrias y plastos no presentan estructuras tan complejas y no están asociados a histonas, aunque sí están asociados a otras proteínas.




      1. TIPOS

Según su estructura se distinguen los siguientes tipos de ADN:




  • Monocatenarios o de una cadena; por ejemplo los de algunos virus.

  • Bicatenarios, con dos hebras o cadenas (algunos virus, las bacterias y los eucariotas).

A su vez, y en ambos casos, el ADN puede ser:




  • Lineal, como por ejemplo el del núcleo de las células eucariotas y el de algunos virus.

  • Circular, como el de las mitocondrias, cloroplastos, bacterias y algunos virus.

    1. ARN.

El ácido ribonucleico (ARN o RNA) es un ácido nucleico, polímero lineal de nucleótidos formando una larga cadena. El eje de la cadena lo forman grupos fosfato y azúcares ribosa de forma alternativa del que toma su nombre. Entre sus bases nitrogenadas contiene al uracilo en vez de a la timina. La función principal del ARN es servir como intermediario de la información que lleva el ADN en forma de genes y la proteína final codificada por esos genes. Fue descubierto por Severo Ochoa.

El ARN es transcrito desde el ADN por enzimas llamadas ARN polimerasas y procesado en el transcurso por muchas más proteínas. El uracilo, aunque es muy diferente, puede formar puentes de hidrógeno con la adenina, lo mismo que la timina lo hace en el ADN. El porqué el ARN contiene uracilo en vez de timina es un enigma del que nadie sabe la respuesta.



      1. COMPOSICIÓN QUIMICA.

El ARN contiene el azúcar pentosa (o sea de con 5 carbonos) llamada ribosa y sus moléculas están formadas también por pares de bases, el nombre que recibe por ello es el de ribonucleico

La unión de pares de bases es semejante a la del ADN, pero difiere en que la adenina (A) se une al uracilo (U), entonces su complemento es:

- Uracilo (U) con Adenina (A)

- Citosina (C) con Guanina (G)

Está formado por la unión de muchos ribonucleótidos, los cuales se unen entre ellos mediante enlaces fosfodiester en sentido 5´-3´ (igual que en el ADN).

Están formados por una sola cadena, a excepción del ARN bicatenario de los retrovirus (sida).



ESTRUCTURA PRIMARIA DEL ARN

Al igual que el ADN, se refiere a la secuencia de las bases nitrogenadas que constituyen sus nucleótidos.



ESTRUCTURA SECUNDARIA DEL ARN

Alguna vez, en una misma cadena, existen regiones con secuencias complementarias capaces de aparearse.





ESTRUCTURA TERCIARIA DE ARN

Es un plegamiento, complicado, sobre la estructura secundaria.



      1. LOCALIZACION.

Es el ácido nucleico más abundante en las células (aparece en proporción más elevada que el ADN).

Existen 3 tipos diferentes de ARN: ARN de transferencia (ARN-t ó t-RNA), ARN ribosomal (ARN-r ó r-RNA) y ARN mensajero (ARN-m ó m-RNA).

Los diversos tipos de ARN participan en la expresión de la información genética contenida en el ADN. Es decir, mientras el ADN es portador de la información genética y dicta órdenes para que la célula elabore las proteínas, el ARN se ocupa de que esas órdenes se ejecuten.

Los 3 tipos de ARN no son sólo diferentes por su estructura sino también por su localización intracelular: aproximadamente la mitad del ARN se encuentra formando parte de los ribosomas (ARN-r), un 25% en el citosol (fundamentalmente ARN-t y un poco de ARN-m), y una proporción significativa en el núcleo (parte asociado de forma no covalente al ADN y parte en el nucleolo). Igual que con el ADN, las mitocondrias y plastos tienen sus propios ARN específicos (aprox. un 15% del ARN total).




      1. TIPOS Y FUNCIONES DE CADA UNO DE ELLOS.

Por su estructura y su función se distinguen tres clases de ARN:






  • El ARNm (ARN mensajero) es un polirribonucleótido constituido por una única cadena sin ninguna estructura de orden superior. Su masa molecular suele ser elevada. Este ARN se sintetiza en el núcleo celular y pasa al citoplasma transportando la información para la síntesis de proteínas.

Sus características son las siguientes:

        1. Cadenas de largo tamaño con estructura primaria.

        2. Se les llama mensajero porque transporta la información necesaria para la síntesis proteica.

        3. Cada ARNm tiene información para sintetizar una proteína determinada.

        4. Su vida media es corta. La duración de los ARNm en el citoplasma celular es de escasos minutos siendo degradados rápidamente por enzimas específicas

        5. En procariontes el extremo 5´posee un grupo trifosfato

        6. En eucariontes en el extremo 5´posee un grupo metil-guanosina unido al trifosfato, y el extremo 3´posee una cola de poli-A

        7. En los eucariontes se puede distinguir también:

          1. Exones, secuencias de bases que codifican proteínas.

          2. Intrones, secuencias sin información.

          3. Un ARNm  de este tipo ha de madurar (eliminación de intrones) antes de hacerse funcional, a ese proceso se le llama splicing. Antes de madurar, el ARNm  recibe el nombre de ARN heterogeneonuclear (ARNhn).



  • El ARNt (ARN de transferencia) transporta los aminoácidos para la síntesis de proteínas. Está formado por una sola cadena, aunque en ciertas zonas se encuentra replegada y asociada internamente mediante puentes de hidrógeno entre bases complementarias. Su peso molecular es del orden de 25.000 da. Está formado por entre 70 y 90 nucleótidos y constituye el 15 % del total del ARN de la célula. Se sintetiza en el núcleo y sale hacia el citoplasma para realizar su función. En el ARNt podemos distinguir un brazo aceptor de aminoácidos abierto y un bucle anticodon.

Sus principales características son.

        1. Son moléculas de pequeño tamaño

        2. Poseen en algunas zonas estructura secundaria, lo que va hacer que en las zonas donde no hay bases complementarias adquieran un aspecto de bucles, como una hoja de trébol.

        3. Los plegamientos se llegan a hacer tan complejos que adquieren una estructura terciaria

        4. Su misión es unir aminoácidos y transportarlos hasta el ARNm  para sintetizar proteínas.

        5. El lugar exacto para colocarse en el ARNm  lo hace gracias a tres bases, a cuyo conjunto se llaman anticodón (las complementarias en el ARNm  se llaman codón).



  • El ARNr (ARN ribosomal) es el ARN de los ribosomas, cuya función es poco conocida.

    Sus principales características son:

        1. Cada ARNr  presenta cadena de diferente tamaño, con estructura secundaria y terciaria.

        2. Forma parte de las subunidades ribosómicas cuando se une con muchas proteínas

        3. Están vinculados con la síntesis de proteínas.



  • Los ARN nucleolar (ARNn) asociado a diferentes proteínas formando el nucléolo, se origina en el núcleo a partir de diferentes segmentos de ADN denominados organizadores nucleolares, luego dan lugar a los diferentes ARNr.



  • Los ARN víricos. Algunos virus tienen como material genético ARN bicatenario.



  • Ribozimas con función catalítica



  • Ribonucleoproteínas se asocian a proteínas y algunas modificaban los ARNm para hacerlos funcionales.



  • Autocatalíticos, es decir, capaces de escindirse en varios fragmentos por si mismos sin ayuda de ninguna enzima. (pag 95)

En la célula eucarionte los ARN se sintetizan gracias a tres tipos de enzimas:

  • ARN polimerasa I, localizada en el nucleolo y se encarga de la síntesis de los ARNr 18 S, 5,8 S y 28 S.

  • ARN polimerasa II, localizada en el nucleoplasma y se encarga de la síntesis de los ARNhn, es decir de los precursores de los ARNm

  • ARN polimerasa III, localizada en el nucleoplasma y se encarga de sintetizar los ARNr 5 S y los ARNm.


http://es.wikipedia.org/wiki/Hip%C3%B3tesis_del_mundo_de_ARN.


    1. FUNCIONES DE LOS ÁCIDOS NUCLEICOS.

Entre las principales funciones de estos ácidos tenemos:

  • Duplicación del ADN

  • Expresión del mensaje genético:

  1. Transcripción del ADN para formar ARNm y otros tipos.

  2. Traducción, en los ribosomas, del mensaje contenido en el  ARNm a proteínas.



    1. ADN Y ARN: DIFERENCIAS A NIVEL QUÍMICO.




  • El ADN (ácido desoxirribonucleico) en sus nucleótidos tiene desoxirribosa como azúcar y no tiene uracilo como base nitrogenada.

  • El ARN (ácido ribonucleico) tiene ribosa y no tiene timina.



El ARN no forma dobles cadenas, salvo en ciertos virus (por ej. los retrovirus). Lo que no quita que su estructura espacial pueda ser en ciertos casos muy compleja.
Ejercicios paginas 98-99: 6, 7, 9, 12, 14, 16, 21

1) Las bases púricas son ....

a) la adenina y la timina;
b) la adenina y la guanina;
c) la citosina y la guanina;
d) la citosina y la timina.
2) La base complementaria de la citosina (C) es ...
a) timina (T);
b) adenina (A);
c) guanina (G);
d) el uracilo (U).
3) La base complementaria de la adenina (A) es ...
a) la timina (T);
b) la citosina (C);
c) la guanina (G);
d) el uracilo (U).
4) Si la base que se observa en la Fig. 1 no es la guanina, entonces será...

a) la citosina;


b) la adenina;
c) la timina;
d) el uracilo.
5) Si la base que se observa en la Fig. 2 se encuentra en el ADN y no es la timina, entonces será...


a) la citosina;
b) la adenina;
c) la guanina;
d) el uracilo.
6) La desoxirribosa se diferencia de la ribosa en que..
a) la ribosa es alfa y la desoxirribosa es beta;
b) a la desoxirribosa le falta un oxígeno en el carbono anomérico;
c) la desoxirribosa no tiene una función alcohol en el carbono dos y la ribosa sí.
d) Ninguna de las respuestas anteriores es correcta.
7) Un nucleótido es:
a) el monómero que forma las proteínas;
b) el monómero que forma los ácidos nucleicos;
c) cada una de las bases de los ácidos nucleicos;
d) la unión del monosacárido y la base nitrogenada.
8) Los componentes de un nucleótido son:
(indicar la respuesta que da el orden correcto)
a) Ácido fosfórico, azúcar, base nitrogenada;
b) Azúcar, fosfórico, base nitrogenada;
c) Azúcar, base nitrogenada, ácido fosfórico;
d) azúcar, base nitrogenada.
9) Los ácidos nucleicos son...
a) polímeros formados por la unión de nucleótidos mediante enlaces peptídicos;
b) polímeros formados por la unión de aminoácidos mediante enlaces peptídicos;
c) polímeros formados por la unión de nucleótidos mediante enlaces fosfoéster;
d) polímeros formados por la unión de nucleótidos mediante enlaces N-glicosídicos.
10) El enlace indicado con un recuadro en la Fig. 3 es un enlace...


a) N-glicosídico;
b) fosfoéster;
c) O-glicosídico.
d) Ninguna de las respuestas anteriores es la correcta pues la fórmula está mal ya que le falta un ácido fosfórico.
11) ¿A qué OH del azúcar, de los que se observan en la Fig. 4, se une el OH del el ácido fosfórico para formar un nucleótido?


a) al 2º;
b) al 3º;
c) al 5º.
d) A ninguno de los tres anteriores.
12) En la Fig. 5 se observa...


a) un ribonucleótido pirimidínico;
b) un desoxirribonucleótido pirimidínico;
c) un ribonucleótido púrico;
d) un desoxirribonucleótido púrico;
13) Los nucleótidos se unen entre sí para formar un polinucleótido mediante enlaces...
a) N-glicosídicos;
b) O-glicosídicos;
c) fosfoéster.
d) Ninguna de las respuestas anteriores es la correcta.
14) En el ADN bicatenario se cumple la siguiente norma:
a) A=T;
b) A=G;
c) A=C.
d) Ninguna de las respuestas anteriores es correcta.
15) En el esquema que se observa en la Fig. 6, 2 representa...


a) la ribosa;
b) la desoxirribosa;
c) la adenina;
d) la timina.
16) En el esquema que se observa en la Fig. 6, 5 representa...


a) la citosina;
b) la adenina;
c) la timina;
d) el uracilo.

17) Refiriéndonos al esquema que se observa en la Fig. 6, una de las siguientes respuestas no es correcta:




a) 1 es el ácido fosfórico;
b) 4 es la citosina;
c) 7 es un nucleótido.
d) El error en realidad está en el dibujo de la propia figura, pues una de las cadenas está al derecho y la otra al revés.
18) El ADN se diferencia del ARN...
a) En que en el ADN no hay timina;
b) En que en el ADN no hay uracilo;
c) En que en el ADN no hay citosina.
d) Ninguna de las anteriores respuestas es correcta.

19) ¿Cómo se llama en general lo que se observa en la Fig. 7 si representa parte de la estructura terciaria de un ácido nucleico?




a) Nucleótido;
b) nucleósido;
c) estructura secundaria;
d) nucleosoma.

20) Lo indicado con un 3 en la Fig. 7 es ...



a) la doble hélice del ADN;


b) el ARNm;
c) las histonas asociadas al ADN;
d) el nucleósido.
21) En la Fig. 8 se observa parte de la estructura de una molécula encontrada en el núcleo de las células eucariotas. ¿Cómo se llama en general lo representado en la figura?


a) La doble hélice del ADN.
b) La fibra de 30 nanometros.
c) Los nucleótidos.
d) El ARNt.
22) El ARNm ....
a) es de cadena simple sin estructura terciaria;
b) asociado a histonas forma los nucleosomas;
c) es de doble cadena sin estructura terciaria.
d) Ninguna de las respuestas anteriores es la correcta.
23) La molécula que se observa en la Fig. 9 es un polinucleótido que no contiene timina. Es por eso que podemos decir que es ...


a) el ADN;
b) el ARNm;
c) el ARNt;
d) el ARNr.
24) El análisis de 4 fragmentos de una molécula de ADN extraída de una bacteria ha proporcionado las composiciones de bases a, b, c y d ¿Cuál desnaturalizará a mayor temperatura?
a) A=25%, T=25%; C=25%, G=25%;
b) A=15%, T=15%; C=35%, G=35%;
c) A=40%, T=40%; C=10%, G=10%;
d) A=30%, T=30%; C=20%, G=20%.
25) El ADP y el ATP son...
a) derivados de ribonucleótidos;
b) derivados de desoxirribonucleótidos;
c) derivados de las bases nitrogenadas.
d) Ninguna de las tres respuestas anteriores es correcta.
26) El ATP/ADP...
a) contienen la información genética;
b) son nucleótidos que intervienen en las transferencias de energía en los seres vivos;
c) son nucleótidos que intervienen en los procesos de oxidación reducción en los seres vivos;
d) Ninguna de las tres respuestas anteriores es correcta.
27) El ARNt....
a) transporta los aminoácidos en la síntesis proteica;
b) se encuentra en los ribosomas;
c) forma parte de la cromatina;
d) Ninguna de las tres respuestas anteriores es correcta.

28) En la gráfica de la Fig. 10 se representa la temperatura de desnaturalización del ADN en función del porcentaje de pares de bases C-G. El estudio de la temperatura de desnaturalización de una muestra de ADN ha permitido determinar que esta es de 87oC. Es por esto que podemos decir que la composición de bases del ADN era...




a) A=25%, T=25%; C=25%, G=25%
b) A=15%, T=15%; C=35%, G=35%;
c) A=40%, T=40%; C=10%, G=10%;
d) A=30%, T=30%; C=20%, G=20%.


Tema 6: Ácidos nucleicos





Compartir con tus amigos:


La base de datos está protegida por derechos de autor ©composi.info 2017
enviar mensaje

    Página principal