Preguntas de selectividad 3er trimestre genética



Descargar 139.14 Kb.
Página1/2
Fecha de conversión08.02.2019
Tamaño139.14 Kb.
  1   2

PREGUNTAS DE SELECTIVIDAD 3er TRIMESTRE

GENÉTICA (Molecular y Mendeliana)

  1. ¿Cómo se denomina el mecanismo que permite la duplicación de la información genética? Explíquelo detalladamente.

  2. Una enfermedad hereditaria provocada por un gen recesivo (d) se manifiesta en todos los hombres portadores de ese gen, pero no en todas las mujeres portadoras. ¿Por qué? Indique todos los genotipos posibles de los individuos normales y enfermos de la población respecto a ese carácter. Razone las respuestas. (la respuesta se basa en el hecho de que se trata de un carácter ligado al sexo, localizado en el cromosoma X. Los Genotipos posibles son: X0X0, X0Xd, XdXd, X0Y, XdY)

  3. Realice un esquema general de cómo se lleva a cabo la expresión genética, describiendo brevemente los procesos implicados en esta expresión y los pasos de que consta cada uno de ellos.

  4. En relación al esquema responda a las siguientes preguntas:



  1. Nombre los procesos señalados con las letras A, B, C y D. Indique la composición de las moléculas incluidas en los recuadros.

  2. Indique una función de cada una de las moléculas incluidas en los recuadros (ADN: portador de la información genética, responsable de los caracteres celulares, etc.; ARN: componente de los ribosomas, transfiere aminoácidos, traduce el mensaje genético a proteínas, portador de la info genética en virus, etc.; Proteínas: enzimática, transporte, movimiento, contracción, soporte mecánico y estructural, nutrición y reserva, inmunidad, hormonal, etc.). Explique en qué consiste el proceso. ¿en qué formas biológicas se ha descrito el proceso A?



  1. Explique los conceptos de gen, mutación, recombinación y segregación cromosómica

  2. A partir de la tabla siguiente indique el tipo de material hereditario (ADN, ARN, cadena sencilla o doble) de los diferentes organismos. Razone la respuestas:

Humano: ADN de cadena doble.

Bacteria: ADN de cadena doble.

Virus de la gripe: ARN de cadena sencilla.

Reovirus: ARN de doble cadena

  1. Defina los siguientes conceptos: replicación, transcripción y traducción. ¿En qué parte de las células procariótica y eucariótica tienen lugar estos procesos? Describa cómo se lleva a cabo la transcripción.

  2. (Raz) Redacte un texto en el que se relacionen de forma coherente los siguientes términos: aminoácidos, poros nucleares, ARN mensajero, ARN transferente, ribosomas, código genético, ADN y proteínas. (hay que relacionar los términos propuestos con el flujo de información genética)

  3. (Raz) ¿Cómo se puede explicar que una célula típica de nuestro cuerpo posea unas 10000 clases diferentes de proteínas si el número de aminoácidos distintos es solamente 20? Razone la respuesta. (el tipo de proteína depende de la secuencia lineal de aminoácidos y la combinación de 20 aminoácidos diferentes puede dar lugar a muchas secuencias primarias distintas)

  4. (Raz) En 1951 Novick y Szilard obtuvieron una estirpe de bacteriófago híbrido entre el fago T2 y el fago T4. Este híbrido tenía la cápsida del fago T4 y el ADN del fago T2. Si este virus híbrido infectara una nueva bacteria, ¿qué ácido nucleico y qué cápsida tendrían los nuevos fagos?. Razone la respuesta.

  5. En relación a la figura adjunta, responda a las siguientes preguntas:

  1. ¿Cómo se denominan los dos procesos biológicos representados? Identifique los distintos elementos de la figura señalados con números.

  2. Identifique los extremos del elemento 2 (a y b) y los extremos del elemento 5 (c y d) ¿Cuál es la composición química de los elementos señalados con los números 3 y 4?

  1. Defina el proceso de Traducción, indique dónde tiene lugar (ribosomas) y describa cómo se realiza (descripción de las 3 etapas: iniciación, elongación y terminación).

  2. (Raz) Las mutaciones generalmente son perniciosas para el individuo que las sufre, sin embargo desde el punto de vista evolutivo son muy importantes. Explique razonadamente esta aparente contradicción.

  3. Si el código genético no fuese universal, ¿qué ocurriría al introducir el gen que codifica la insulina de ratón en una bacteria? Razone la respuesta (Se debe razonar que no se produciría proteína (insulina) alguna o que, en caso de producirse, ésta no sería funcional)

  4. Exponga el concepto de mutación y explique sus consecuencias (evolutivas y perjudiciales). Indique la diferencia entre mutaciones espontáneas e inducidas y cite dos ejemplos de agentes mutagénicos (cualquier agente físico, químico o biológico).

  5. Observe la figura adjunta y conteste:





  1. ¿Cómo se llama el proceso representado en el esquema? Identifique los elementos señalados con las letras A y B, indicando cuáles son sus principales semejanzas y diferencias.

  2. Indique la finalidad, dónde se realiza y describa las etapas del proceso que se representa. Indique qué significado en el esquema las anotaciones 5’ y 3’.



  1. Nombre, al menos, tres agentes mutagénicos que conozca. Exponga las consecuencias biológicas de las mutaciones.

  2. Defina los siguientes conceptos: replicación, transcripción y traducción. ¿En qué parte de la célula procariota y eucariota tienen lugar estas funciones celulares? Describa cómo se lleva a cabo la transcripción.

  3. En Drosophila (la mosca del vinagre) los genes que determinan el color del cuerpo y el tamaño de las alas van en el mismo cromosoma. Consideremos una hembra heterocigota para ambas características, ¿Qué tipo de gametos podría formar si hay recombinación?, ¿Y si no hubiese recombinación?. Si consideramos una hembra homocigota para ambos caracteres, ¿Qué tipo de gametos podría formar si hay recombinación?, ¿Y si no hubiese recombinación?

  4. Explique las funciones de los distintos ARN que intervienen en la síntesis de proteínas.

  5. Explique razonadamente cómo se puede comprobar si una enfermedad tiene carácter hereditario o no. Responda razonadamente a las siguientes preguntas: ¿Las enfermedades genéticas tienen curación?, ¿las enfermedades genéticas tienen tratamiento, de tal manera que puedan disminuir o incluso eliminarse los síntomas de la enfermedad?

  6. Defina los siguientes conceptos: mutación espontánea, mutación inducida y agente mutagénico. Realice una clasificación de los agentes mutagénicos, exponiendo los argumentos utilizados e ilustrando la clasificación con ejemplos.

  7. Clasifique los tipos de bacterias en función de la fuente de Carbono y Energía que utilizan y justifique la respuesta.

  8. Por la acción de un mutágeno se produce la sustitución de una base por otra en una de las cadenas de un gen que codifica una proteína. Sin que se produzca reparación tienen lugar sucesivas divisiones celulares. ¿Presentan todas las células descendientes la mutación? ¿Por qué? (no, al presentarse el ADN mutado sólo en una de las dos células hijas) Explique en qué medida puede verse afectada la funcionalidad de la proteína sintetizada en una de las células mutantes (desde pasar desapercibida, en caso de que el nuevo codón codifique para el mismo aminoácido, hasta que se produzca una proteína no funcional, inactiva).

  9. (Raz) Redacte un texto en el que se relacionen de forma coherente los siguientes términos: aminoácidos, poros nucleares, ARN, ribosomas y ADN.

  10. (Raz) ¿Tienen las mismas consecuencias las mutaciones que se producen en las células somáticas que las que se producen en las células germinales? Razone la respuesta. (hay que indicar que las primeras no se transmiten a la descendencia y las segundas sí).

  11. Explique qué es la regulación génica y por qué es necesaria. ¿Qué son los genes estructurales y los reguladores?

  12. Si se conociese la secuencia de aminoácidos de una proteína, ¿podría determinarse exactamente la secuencia de nucleótidos del ADN que la codifica? (No, básicamente por la degeneración del código genético; también por la maduración del ARNm, etc.) ¿Ha aportado el descubrimiento del código genético alguna evidencia a favor de la teoría que considera que todos los seres vivos tienen un origen común? (la universalidad del código como factor favorable a la teoría) Razone ambas respuestas.

  13. A la vista de la siguiente imagen, conteste:





  1. Indique razonadamente de qué proceso se trata (Transcripción, por la presencia de una doble hebra de ADN y una de ARN). ¿en qué lugar de a célula se produce? (Núcleo eucariota, citosol procariótico y en mitocondrias y cloroplastos) ¿Cómo afectaría a este proceso una elevación brusca de la Tª por encima de los 80 ºC? (se produce la desnaturalización del ADN y de las enzimas)

  2. Explique la composición y estructura de la molécula resultante. ¿cuáles son las posibles funciones de esta molécula? (funciones del ARNm, ARN t y ARNr).

  1. Explique el concepto de Transcripción, indique dónde tiene lugar y cómo se realiza. ( en la explicación no puede faltar: que se produce la copia de una sola hebra de ADN, la acción de la ARN polimerasa, el papel de las señales de inicio y terminación)

  2. (Raz) La Tercera Ley de Mendel no se cumple en determinados casos, ¿en cuáles? Razone la respuesta. (no se cumple cuando los factores mendelianos (los genes) están ligados en el mismo cromosoma y en la herencia ligada al sexo).

  3. Defina el concepto de gen (fragmento de ADN y unidad genética funcional) y de cromosoma (estructura portadora de la información genética, visible en la mitosis, constituida por ADN y proteínas). ¿Cuáles son los componentes moleculares de los cromosomas? (ADN y proteínas histonas) Explique la estructura de los cromosomas (enrollamiento y superenrollamiento de la cromatina)

  4. (Raz) Al hacer un análisis de la composición química del núcleo se ha detectado la presencia de muchas enzimas, aunque en él no existen ribosomas. Da una explicación razonada de este hecho (estas enzimas llegan a través de los poros nucleares procedentes del citoplasma donde han sido sintetizadas). ¿Para qué son necesarias estas enzimas? Razone la respuesta (son necesarias para la síntesis de ácidos nucleicos, ADN y ARN, y para su regulación).

  5. Se presenta un fragmento de ADN; la flecha indica el sentido de lectura. Además se muestra el código genético. Conteste las siguientes cuestiones:





  1. Indique la secuencia de bases del ARN mensajero transcrito (AUGCCCUCUAGUGGAGUAAUCCACUGGUAA) y la secuencia de aminoácidos de la proteína sintetizada (MET-PRO-SER-SER-GLY-VAL-ILE-HIS-TRP (STOP).

  2. ¿Cómo se llaman los procesos implicados en el apartado anterior? (Transcripción y Traducción) Si se conociese la secuencia de aminoácidos de una proteína, ¿se podría averiguar la secuencia de bases del ADN que la codifica? (No, por varias razones: código genético degenerado, eliminación de intrones…)

  1. Explique qué se entiende por Código Genético (relación entre la secuencia de bases del ARNm y la secuencia de aminoácidos correspondiente). Explique los términos codón (grupo de 3 bases que codifica un aminoácidos) y anticodón (triplete de bases del ARNt que se une de forma complementaria a un triplete del ARNm y aporta el aminoácido para el que codifica dicho codón) ¿Qué son los codones sin sentido o de terminación? (no corresponden a ningún aminoácido) Explique dos características del Código Genético (universalidad y degenerado: explicación…).

  2. (Raz) La semejanza que existe entre los hijos y sus padres es explicable por dos de los siguientes procesos: replicación, transcripción, traducción, reproducción sexual. Indique cuáles. Razone la respuesta. (Replicación, necesario para la duplicación del material genético en los padres, y la Reproducción Sexual, que permite que el ADN replicado pase de una generación a otra)

  3. La figura siguiente representa los resultados del experimento que Meselson y Stahl realizaron en relación con la replicación del ADN. Responda razonadamente las siguientes cuestiones:

  1. Interprete esta experiencia a partir de sus conocimientos sobre la estructura del ADN y su mecanismo de replicación (conceptos clave: doble hélice de ADN; hipótesis semiconservativa de la replicación).

  2. ¿Cuál sería el aspecto de un quinto tubo de centrifugación obtenido a partir del cultivo sobre medio con N15 tres generaciones después de su transferencia al medio con N14? (aparecería una banda estrecha de ADN híbrido (con N15) y otra más ancha de ADN ligero (con N14)) ¿Qué aspecto tendría un sexto tubo de centrifugación obtenido a partir del cultivo sobre medio con N15 tras 100 generaciones después de su transferencia al medio con N14? (aparecería una sola banda de ADN ligero, N14)

  1. Explique razonadamente por qué el orden de los nucleótidos en el ADN determina los caracteres de los organismos como son: el tipo de pelo, el color de los ojos, etc. (El ADN contiene la información para sintetizar proteínas. Serán éstas las que, al actuar en las reacciones biológicas, den lugar a la aparición de los caracteres. La secuencia de nucleótidos en la molécula de ADN determina la secuencia de aminoácidos en las proteínas)

  2. La difteria está producida por la acción de la toxina de Corynebacterium diphtheriae. La toxina impide la acción de la translocasa, enzima que favorece el movimiento del ARN mensajero en el ribosoma. El efecto de esta toxina puede matar a la célula. Explique razonadamente este hecho. (hay que explicar que la toxina está ocasionando la detención de la síntesis proteica)

  3. Indique qué es la Replicación (proceso de duplicación del ADN, es decir, producción de dos moléculas de ADN hijas a partir de una molécula de ADN molde) y describa el proceso (debe incluir: horquillas de replicación, replicación bidireccional, replicación continua de una hebra y discontinua de la otra, papel fundamental de las enzimas). ¿Qué significa que la replicación es semiconservativa? (que cada molécula de ADN hija presenta una hebra antigua (del ADN molde) y otra de nueva síntesis)

  4. Defina el término mutación (alteración del material genético) y distinga entre mutaciones espontáneas e inducidas. Comente dos ejemplos en los que se pongan de manifiesto los efectos perjudiciales de las mutaciones (cáncer, enfermedades genéticas, etc.).

  5. A la vista de la imagen, responda a las siguientes preguntas:

  1. ¿Qué proceso se representa en el esquema? (Traducción o biosíntesis de proteínas) Identifique las estructuras y las moléculas que aparecen en el dibujo (Ribosoma, ARNm, ARNt y aminoácidos).

  2. Explique cómo se lleva a cabo el proceso representado (se debe hacer mención a todas las moléculas de ácidos nucleicos que intervienen en el proceso y a la función que desempeña cada una).

  1. Indique el significado de las siguientes afirmaciones: las dos hebras de una molécula de ADN son antiparalelas (que una va en sentido 5’-3’ y la otra al contrario); la replicación del ADN es semiconservativa (que las hebras de ADN resultantes tienen una hebra procedente de la molécula de ADN madre y otra de nueva síntesis); la replicación del ADN es bidireccional (que en cada origen de replicación, la replicación se produce en los dos sentidos originando dos horquillas de replicación, estructuras en forma de Y, una en cada extremo de la burbuja de replicación); una de las cadenas del ADN se replica mediante fragmentos de Okazaki (Durante la replicación, la síntesis de una cadena que se copia a partir de la hebra de ADN molde 3’-5’ se realiza de forma continua, mientras que la otra, la que se copia a partir de la hebra de ADN molde 5’-3’, se sintetiza por medio de pequeños fragmentos llamados de Okazaki; esto es debido a que la ADN polimerasa sólo polimeriza en sentido 5’-3’). Razone las respuestas.

  2. (Raz) La estreptomicina impide que el primer ARN transferente se una al ribosoma bacteriano. Explique razonadamente su efecto antibiótico (el antibiótico está ocasionando la detención de la síntesis proteica bacteriana).

  3. (Raz) El color negro de la piel de una especie de ratón depende del alelo dominante (B), y el color blanco de su alelo recesivo (b). Si una hembra de color negro tiene descendientes de piel blanca, ¿cuál es el genotipo de la hembra? ¿Qué genotipos y fenotipos podría tener el macho que se cruzó con ella? Razone las respuestas. (la hembra es heterocigota (Bb) y el macho puede ser heterocigoto u homocigoto recesivo (bb))

  4. Indique la finalidad del proceso de replicación (duplicación del material genético) y en qué período del ciclo celular tiene lugar (fase S de la Interfase). Explique qué es un cebador (fragmento del ARN que proporciona el extremo 3’OH para el inicio de la polimerización del ADN) y un fragmento de Okazaki (fragmentos de ADN por los que se va replicando la cadena retrasada, a partir de la hebra 5’-3’ del ADN molde) y por qué es necesaria su presencia en el proceso de replicación. Explique brevemente el proceso de replicación (debe mencionarse el origen de replicación, cadenas adelantada y retrasada, cebador, fragmento de Okazaki, ADN y ARN polimerasas y Ligasas).

  5. En relación con este esquema, responda a las siguientes preguntas:

  1. ¿Cómo se denominan cada uno de los pasos indicados con flechas en el esquema y dónde se llevan a cabo en una célula eucariótica? Escriba qué codones corresponden a cada uno de los 5 aminoácidos. Si una mutación puntual provoca que la primera base de la molécula 2 pase a ser una C en vez de una A, ¿qué cambio se origina en la secuencia de la molécula 3?

  2. Describa brevemente el proceso de síntesis de la molécula 3 e indique las fases de las que consta.

  1. En los humanos la fibrosis quística se produce por el alelo recesivo de un gen autosómico con dos alelos (A: alelo normal; a: alelo de la fibrosis quística). En una pareja en la que la mujer es heterocigótica y el varón presenta fibrosis quística, indique para este gen los tipos y las proporciones de los óvulos de la mujer y espermatozoides del hombre y los fenotipos y genotipos de la descendencia. Razone las respuestas. (Óvulos: 50% A t 50 % a. Espermatozoides: 0 % A y 100 % a. Descendencia: sanos Aa el 50 % y con fibrosis quística aa el otro 50 %).

  2. Exponga razonadamente si el ADN de una célula de la piel de un individuo contendrá la misma información genética que una célula del hígado. ¿Sintetizan las dos células las mismas proteínas? Razone las respuestas.

  3. Explique el concepto de gen y de genoma. ¿Qué es el código genético? Explique qué significa que el código genético es universal y degenerado.

  4. ¿Podrían los 20 aminoácidos estar codificados por un código genético constituido por dipletes de las cuatro bases nitrogenadas? Razone la respuesta. No, porque sólo se podrían formar 16 dipletes diferentes y hacen falta al menos 20 para poder codificar los 20 aminoácidos diferentes presentes en las proteínas.

  5. Explique brevemente el proceso de replicación. Indique la finalidad de este proceso y el significado de la afirmación: “la replicación del ADN es semiconservativa”.

  6. Suponga que en un fragmento de ADN que codifica un polipéptido se produce una mutación que cambia un par de bases por otro. Debido a ello, cuando la célula sintetice de nuevo el polipéptido pueden ocurrir cualquiera de los cuatro hechos siguientes:

1. Que se codifique el mismo aminoácido. (se debe al hecho de que el código genético es degenerado)

2. Que se sustituya un aminoácido por otro distinto. (se debe a una mutación que ha cambiado un codón a otro que codifica para otro aminoácido)

3. Que el nuevo polipéptido sintetizado sea más corto. (la mutación produce un codón de parada que impide que se sintetice el polipéptido en su totalidad)

4. Que el nuevo polipéptido sintetizado sea más largo. (la mutación ha modificado al codón de terminación convirtiéndolo en otro que sí que codifica un aminoácido y permite la síntesis de un polipéptido más grande)

Basándose en sus conocimientos del código genético, explique cómo se produciría cada uno de estos resultados

  1. En relación a la figura adjunta, conteste a las siguientes cuestiones:

  1. ¿Qué representan los esquemas 1 y 2? La primera (1) y la segunda (2) ley de Mendel (alternativamente un cruce entre homocigóticos y un cruce entre heterocigóticos) Indique que representan la letras A (Alelo dominante) y a (alelo recesivo) y los pares de letras AA (homocigoto dominante), Aa (heterocigoto) y aa (homocigoto recesivo)

  2. Explique los distintos porcentajes que aparecen en los esquemas 1 y 2 (los individuos AA y aa sólo producen un tipo de gameto y los Aa producen dos en igual cantidad; el cruce entre dos homocigóticos da lugar, exclusivamente, a heterocigóticos y el cruce entre dos heterocigóticos produce los tres genotipos posibles en las proporciones 1:2:1). Represente el cruce Aa x aa utilizando un esquema similar a los de la figura, incluyendo los valores de los porcentajes.

  1. Defina qué es un cruzamiento prueba (Cruzamiento entre un individuo de fenotipo dominante y un individuo homocigótico recesivo a fin de poder averiguar el genotipo del primero) y realice un esquema del mismo utilizando símbolos genético. Defina herencia intermedia (Los dos alelos implicados en un carácter se expresan con la misma intensidad, de forma que los híbridos manifiestan un fenotipo intermedio diferente al de los homocigotos de ambos alelos) y realice un esquema de la misma usando símbolos genéticos. Utilice para la realización de los esquemas los símbolos A y a.

  2. En relación a la figura adjunta sobre el flujo de la información genética, responda a las siguientes preguntas:



  1. Nombre cada uno de los procesos biológicos que se indican con las letras a, b, c y d. Relacione cada uno de estos procesos con: ARN polimerasa dependiente de ADN, ribosomas, ADN polimerasa, anticodón, transcriptasa inversa, aminoácidos, ARN transferente y cebadores de ARN.

  2. Exponga la función de cada uno de estos procesos.

  1. (Raz) a) Si un polipéptido tiene 450 aminoácidos, indique cuántos ribonucleótidos tendrá el fragmento del ARN mensajero que codifica esos aminoácidos (450 x 3 = 1350 ribonucleótidos). b) Indique cuáles serán los anticodones de los ARN transferentes correspondientes a la molécula de ARNm 5'-GUU-UUC-GCA-UGG-3' (CAA, AAG, CGU, ACC). c) Indique la secuencia de ADN que sirvió de molde para este mismo ARN mensajero (3’-CAAAAGCGTACC-5’).

  2. Explique cuál es la finalidad de la replicación y de la transcripción. Explique la traducción. Dibuje el inicio de la traducción.

  3. (Raz) a) Complete la tabla que aparece a continuación que corresponde a las cadenas complementarias de un fragmento de ADN.Utilice las letras: P para el ácido fosfórico, D para la pentosa (2' desoxirribosa), A para adenina, C para citosina, G para guanina y T para timina. Indique, en cada caso, el número de puentes de hidrógeno que se establecen entre las dos bases nitrogenadas.



b) Al analizar las proporciones de bases nitrogenadas de un fragmento monocatenario de ADN humano los resultados fueron los siguientes: 27% de A, 35% de G, 25% de C y 13% de T. Indique cuáles serán las proporciones de bases de la cadena complementaria. (13% de A, 25% de G, 35% de C y 27 % de T)

  1. En relación a la figura adjunta, conteste a las preguntas:

  1. Nombre el tipo de molécula de que se trata. Cómo se denominan sus monómeros y cuál es su composición. Considerando la molécula en sentido longitudinal, las notaciones 3' y 5' se sitúan en posiciones opuestas. Explique el significado de este hecho.

  2. ¿Cómo se denomina el proceso por el cual esta molécula se duplica? Explíquelo brevemente.



  1. Defina los siguientes conceptos: gen, alelo, homocigoto y herencia intermedia. Explique la segunda ley de Mendel utilizando un ejemplo. ¿En qué consiste el cruzamiento prueba?

Gen: fragmento de ADN y unidad genética funcional

Alelo: cada una de las formas alternativas que puede presentar un gen

Homocigoto: individuo en el que los dos alelos de un gen son iguales.

Herencia intermedia: cuando los híbridos de la primera generación filial muestran caracteres intermedios entre los dos progenitores

Explicación de la 2ª Ley de Mendel con cruce de híbridos

Cruzamiento prueba: cruce entre un individuo de fenotipo dominante y un individuo homocigótico recesivo a fin de poder averiguar el genotipo del primero

  1. (Raz) ¿Qué característica tiene el código genético que permite que un gen de un organismo pueda expresarse en otro? Razone la respuesta. (carácter universal)

  2. (Raz) Indique las proporciones de los distintos genotipos en la descendencia del siguiente cruzamiento AaBb x AaBb. Razone la respuesta.

AABB: 1/16; AABb: 2/16; AAbb: 1/16; AaBB: 2/16; aaBB: 1/16; AaBb: 4/16; aaBb: 2/16; Aabb: 2/16; aabb: 1/16

  1. En relación a la figura adjunta, responda a las siguientes preguntas:

  1. ¿Qué tipo de molécula representa? (ARNt) Explique su composición indicando el tipo de enlace que se produce entre sus componente (nucleótidos unidos por enlaces fosfodiéster). ¿Cumple esta molécula la relación [purinas]/[pirimidinas]=1? (No, dado que no es una molécula bicatenaria)

  2. Explique su función indicando el nombre y la implicación en la misma de las regiones señaladas con los números 1 y 2. (Transporte de aminoácidos al ribosoma para la síntesis proteica. Nº1: Brazo Aceptor del aminoácido correspondiente al Anticodón. Nº 2: Anticodón, reconocimiento y unión al triplete de nucleóticos del ARNm o codón)

  1. A un óvulo de una hembra A, se le elimina su núcleo y se le introduce el núcleo de una célula somática de un individuo B, y posteriormente se implanta en el útero de una hembra C. Si los individuos A, B y C son de la misma especie, ¿a quién se parecerán las características genéticas del individuo resultante? Razone la respuesta (se parecerán al B pues proceden del material genético de este individuo).

  2. Explique qué se entiende por código genético (Relación entre secuencia de bases (ARN mensajero) y secuencia de aminoácidos (proteínas)). Defina los términos codón (grupo de tres bases (tripletes) del ARN mensajero que codifica un aminoácido) y anticodón (triplete de bases del ARN transferente). ¿Qué son los codones sin sentido o de terminación? (Codones que no corresponden a ningún aminoácido) Describa dos características del código genético (universal y degenerado).

  3. En cierta especie animal, el pelo gris (G) es dominante sobre el pelo blanco (g) y el pelo rizado (R) sobre el liso (r). Se cruza un individuo de pelo gris y rizado, que tiene un padre de pelo blanco y una madre de pelo liso, con otro de pelo blanco y liso.

a) ¿Pueden tener hijos de pelo gris y liso? (sí) En caso afirmativo, ¿en qué porcentaje? (25% de los descendientes será Ggrr (pelo gris y liso)

b) ¿Pueden tener hijos de pelo blanco y rizado? (sí) En caso afirmativo, ¿en qué porcentaje? (el 25% de los descendientes serán ggRr) Razone las respuestas.

  1. Cite y defina los dos procesos que tienen lugar en la expresión de la información genética (transcripción, síntesis de una cadena de ARN que tiene la secuencia complementaria de una cadena de ADN que actúa como molde, y traducción, síntesis de una cadena polipeptídica a partir de una secuencia de ARNm). Indique si alguno de estos procesos podría darse en sentido inverso (transcripción inversa) y en qué tipo de microorganismos se produce (retrovirus o virus de ARN). Explique la función de los distintos tipos de ARN en la expresión génica (ARNr forma parte de los ribosomas; ARNt transporta los aminoácidos de forma específica; ARNm contiene el mensaje genético).

  2. (Raz) Indique si las afirmaciones siguientes son ciertas o falsas, razonando la respuesta:

a) Si en un ARNm se introduce un uracilo en la posición donde debería colocarse una citosina se produce una mutación. Falsa: puesto que un cambio en el ARNm no es una mutación, las mutaciones se producen por cambios en el ADN

b) En eucariotas el ARNm puede ser traducido nada más sintetizarse. Falsa: en eucariotas la síntesis de ARNm y su maduración se produce dentro del núcleo por lo que debe salir de él para ser traducido en el citoplasma

c) En una horquilla de replicación las dos hebras del ADN se replican en sentido 5´→3’. Verdadera: las ADN polimerasas sintetizan en sentido 5´→3´. Por ello, una de las hebras se sintetiza de manera continua (la hebra adelantada), mientras que la otra (la retrasada) lo hace de manera fragmentada (fragmentos de Okazaki)

d) Si dos genes tienen secuencias de tripletes diferentes codificarán siempre cadenas peptídicas diferentes. Falsa: no siempre puede afirmarse tal cosa ya que el código genético es degenerado, es decir varios tripletes diferentes pueden codificar el mismo aminoácido.

  1. (Raz) Explique razonadamente por qué el orden de los nucleótidos en el ADN determina los caracteres del fenotipo de los organismos. La secuencia de nucleótidos en la molécula de ADN determina la secuencia de aminoácidos en las proteínas y por tanto el fenotipo del organismo.

  2. Defina el término mutación (alteración del material genético) y distinga entre mutaciones espontáneas (Las mutaciones espontáneas se producen de forma natural en los individuos) e inducidas (Las mutaciones inducidas se producen como consecuencia de la exposición a agentes mutagénicos químicos o físicos). Comente dos ejemplos en los que se pongan de manifiesto los efectos perjudiciales de las mutaciones (Efectos perjudiciales: cáncer, enfermedades genéticas, etc.).

  3. (Raz) En la especie humana, el color de ojos es un carácter autosómico donde el alelo del color marrón “A” domina sobre el azul “a”. Un hombre de ojos marrones, cuya madre tiene ojos azules, tiene dos descendientes con una mujer de ojos azules. ¿Cuáles son los genotipos del hombre y de la mujer? (el hombre tiene que ser heterocigoto “Aa” para dicho carácter porque ha heredado el alelo recesivo de su madre de ojos azules, homocigota recesiva “aa”; la mujer es homocigota recesiva “aa” por tener los ojos azules) ¿y los de los descendientes? (heterocigotos “Aa” u homocigotos recesivos “aa”) ¿cuál es la probabilidad de que esta pareja tenga descendientes con los ojos azules? (50%) ¿Y la probabilidad de tener descendientes con ojos marrones? (50 %) Razone la respuesta.

  4. En humanos la presencia de una fisura en el iris está regulada por un gen recesivo ligado al sexo (Xf). De un matrimonio entre dos personas normales nació una hija con el carácter mencionado. El marido solicita el divorcio alegando infidelidad de la esposa. Explique el modo de herencia del carácter indicando los genotipos del matrimonio y a qué conclusión debe llegar el juez en relación a la posible infidelidad de la esposa teniendo en cuenta el nacimiento de la hija que presenta la fisura. (Genotipo de la mujer (XFXf) y del marido (XFY). Para que la mujer pueda tener una hija con fisura en el iris debe haberle sido infiel a su marido con un individuo que también presentase fisura (excepto frecuencia de mutación del gameto masculino)

  5. (Raz) Una pareja de fenotipo normal para la pigmentación tiene un hijo albino. Explique el modo de herencia del albinismo e indique los genotipos de los padres y del hijo (el albinismo es un carácter autosómico recesivo ya que si no fuese así la pareja no podría tener un hijo albino, y los genotipos de ambos padres son Aa, siendo el hijo aa). ¿Qué proporción de hijos no albinos se puede esperar en la descendencia? (75%)¿Y de hijos albinos? (25%)Razone las respuestas.

  6. Según el sistema AB0 de grupos sanguíneos humanos, los individuos con sangre del grupo AB presentan en la superficie de sus eritrocitos antígenos de tipo A y antígenos de tipo B, mientras que los individuos con sangre del grupo 0 no presentan estos antígeno, ¿por qué en el caso de transfusiones sanguíneas a los individuos con sangre AB se les considera receptores universales y a los de tipo 0 donantes universales? Razone la respuesta. (un individuo con sangre del grupo AB, que tiene antígenos del tipo A y B, no produce anticuerpos para estos antígenos y, por tanto, puede recibir sangre de donantes de cualquier grupo sanguíneo. Los individuos con sangre del grupo 0 no tienen los antígenos A ni B y, por tanto, pueden donar a cualquier receptor porque no le introducen antígenos extraños)

  7. La información genética de los retrovirus, que está en forma de ARN, puede insertarse en el ADN de la célula huésped. Dé una explicación razonada a este hecho. (la respuesta se basará en que mediante la transcriptasa inversa se hace una copia de la cadena de ARN en ADN y esta última se puede integrar en el genoma de la célula hospedadora)

  8. (Raz) El color de la flor de un tipo de violetas está determinado por un gen con dos alelos con herencia intermedia. El alelo R determina el color rojo y el r el color blanco. Las plantas heterocigóticas tienen flores rosas. En los cruzamientos Rr X RR; rr X Rr; Rr X Rr indique qué gametos se formarán en cada parental y cuál será el fenotipo de las flores en la siguiente generación.

Rr X RR: gametos del individuos Rr (R y r) y del individuo RR (R)

rr X Rr: gametos del individuo rr (r) y del individuo Rr (R y r)

Rr X Rr: gametos de los dos individuos (R y r)

Descendencia del primer cruce: flores rojas y rosas.

Descendencia del segundo cruce: flores blancas y rosas

Descendencia del tercer cruce: flores rojas, rosas y blancas



  1. Considere una célula en la que una determinada molécula de ADN de cadena doble presenta una proporción de Adenina del 30%. ¿Cuál será en dicha molécula la proporción de: T (30%), G (20%), C (20%), bases púricas (50%) y bases pirimidínicas (50%)? Indique si todas las moléculas de ADN de dicha célula presentan los mismos porcentajes de A, T, G, C, bases púricas y pirimidínicas? La secuencia será diferente y variarán los porcentajes de cada base, pero no variarán los porcentajes de bases púricas y pirimidínicas que serán del 50 % cada una) Razone la respuesta.

  2. Ni Luís ni María tienen distrofia muscular de Duchenne (enfermedad ligada al sexo), pero su hijo primogénito sí. Indique si el alelo responsable es dominante o recesivo (es recesivo porque la madre no presenta la enfermedad) y los genotipos de los padres y del hijo (madre- XAXa, padre- XAY e hijo- XaY). Si tienen otro hijo varón, ¿cuál es la probabilidad de que padezca esta enfermedad? (la probabilidad de que otro hijo varón tenga la enfermedad es del 50 %) ¿Y si es una hija? (0%) Razone la respuesta.

  3. Un investigador encuentra que entre los ratones de su laboratorio se ha producido una mutación espontánea en un macho. Tras cruzarlo con una hembra normal, comprueba que en la descendencia ningún macho presenta la mutación, pero en cambio sí la presentan todas las hembras. Indique qué tipo de mutación ha podido producirse (una mutación dominante en el cromosoma X). ¿Qué porcentaje de individuos mutantes cabría esperar en la descendencia si se cruza una hembra mutante (del cruce anterior) con un macho normal? Razone las respuestas.

Porcentajes: 50 % de machos mutantes y 50 % de hembras mutantes.



MICROBIOLOGÍA

  1. Nombre las fases fundamentales del ciclo lítico de un virus. Descríbelas de forma breve y señale la diferencia de un ciclo viral lisogénico.

  2. Defina un virus y describa el Ciclo Lítico de un bacteriófago.

  3. Defina el concepto de biotecnología y describa una aplicación de la misma en la a que intervengan bacterias.

  4. A la vista de la imagen que representa el virus del VIH, conteste a las preguntas:

  1. Indique la naturaleza molecular de los elementos indicados con los números (1: bicapa liipídica; 2: proteínas de cubierta; 3: proteína de la cápsida). Indique qué tipo de ácido nucleico contiene este virus (ARN), qué tipo de células pueden ser infectadas por este virus (linfocitos T4 provocando su destrucción y desactivando la respuesta inmune tanto celular como humoral) y las consecuencias de ello (desactivación de la respuesta inmune tanto celular como humoral).

  2. Explique el ciclo del virus del VIH. (El ciclo comienza con la interacción del retrovirus con una glucoproteína de membrana de la célula hospedadora, lo que provoca la fusión de la membrana del virus y de la célula con la consiguiente del retrovirus al interior celular; tras la pérdida de la cubierta proteica se inicia la retrotranscripción del ARN vírico gracias a la retrotranscriptasa, que sintetiza un ADN bicatenario que se integra en el cromosoma de la célula hospedadora. El siguiente paso es la expresión del ADN viral que conduce a la formación de ARN víricos, que se traducen para originar las proteínas estructurales y enzimáticas del virus; tras el ensamblaje de los viriones éstos pueden liberarse para reiniciar un nuevo ciclo infectando nuevas células diana).

  1. Defina los siguientes términos: microorganismo (ser vivo de pequeño tamaño que no puede ser percibido por el ojo humano sin la ayuda de un microscopio), bacteriófago (virus que infecta bacterias), célula procariótica (célula que no posee núcleo verdadero), biotecnología (conjunto de procesos industriales que utilizan microorganismos o células procedentes de animales o vegetales para obtener determinados productos) y ciclo lítico (ciclo de multiplicación de los bacteriófagos en el que el genoma del virus no se incorpora al de la bacteria).

  2. Un virus permanece permanentemente inerte si no está en contacto con la célula hospedadora, ¿por qué? Proporcione argumentos a favor y en contra de que los virus sean considerados organismos vivos.

  3. Copie la siguiente tabla y rellene las casillas indicando las características de cada grupo de microorganismos.



  1. El material genético de un virus tiene la siguiente composición en bases: Adenina 22% Uracilo 27% Citosina 23% Guanina 28%. A partir de estos datos responda razonadamente: ¿Qué tipo de material genético tiene este virus? (ARN ya que presenta Uracilo en vez de Timina) ¿Está formado por una sola cadena o por dos complementarias? (Es monocatenario, ya que los porcentajes de las bases no se ajustan al criterio de complementariedad: %A = %U; %C = %G) Razone las respuestas.

  2. ¿Por qué en el tratamiento de enfermedades producidas por microorganismos los médicos recetan en unos casos antibióticos y en otros no? (Los antibióticos eliminan bacterias y no virus y se recetan cuando la enfermedad es bacteriana) ¿Qué problemas causa el uso indiscriminado de los antibióticos en la lucha contra los microorganismos? (Los antibióticos pueden seleccionar bacterias resistentes a su acción y dejan de tener efecto) Razone las respuestas.

  3. Nombre tres tipos de microorganismos con organización celular eucariota. Describa las características estructurales y funcionales de cada uno de ellos.

  4. Explique las diferencias entre: bacteria, alga, protozoo y hongo.

  5. Explique tres aplicaciones biotecnológicas de los microorganismos en la alimentación o sanidad. (ej: obtención de hormonas, fermentaciones industriales, alimentos transgénicos, etc.)

  6. (Raz) Las leguminosas tienen en sus raíces bacterias fijadoras de nitrógeno. ¿Qué ventajas presentan estas plantas desde el punto de vista agrícola? (el enriquecimiento de suelos pobres en nitrógeno)

  7. El siguiente dibujo representa un ciclo biológico muy frecuente:





  1. ¿De qué proceso se trata y qué organismos se encuentran representados?



  1. Explique qué ocurre en cada momento.

  1. Indique en qué consiste la selección artificial como procedimiento tradicional de mejora genética. Comente un ejemplo de selección artificial aplicada a la producción agropecuaria.

  2. Explique el concepto de microorganismo. Señale tres tipos de microorganismos que presenten características estructurales y/o funcionales diferentes y describa estas diferencias.

  3. (Raz) El material genético de los ADN-virus puede estar formado por una sola cadena de nucleótidos (ADN unicatenario) o por dos (ADN bicatenario). Si el análisis cuantitativo del ADN del virus muestra que tiene 40% de G y 30 % de A, ¿puede afirmarse que sea un ADN unicatenario? Razone la respuesta.

  4. Exponga las características que nos permiten definir los siguientes tipos de organismos: alga, hongos y protozoos. (Algas: eucariotas, fotosintéticos, autótrofos, unicelulares o pluricelulares; hongos: eucariotas, no fotosintéticos, heterótrofos, unicelulares o pluricelulares sin diferenciación de tejidos; Protozoos: eucariotas binucleados, no fotosintéticos, heterótrofos, unicelulares, etc.) Exponga tres diferencias que puedan establecerse entre estos microorganismos y los procariotas. (deben hacer alusión a la organización procariota)

  5. Se ha fabricado un bacteriófago con la cubierta proteica del fago T2 y el ADN del Fago T4. Si este nuevo fago infecta a una bacteria, indique cual de los dos tipos de cubierta (T2 y T4) y de ADN (T2 y T4) presentaría los fagos producidos por la bacteria hospedadora. Razone la respuesta. (El razonamiento se basa en que el ADN es la molécula portadora de la información genética, por lo tanto, los nuevos virus llevarán tanto la cápsida como el material genético del Fago T4)

  6. Suponga que desaparecieran todas las bacterias de la Tierra. Proponga de manera razonada cuatro argumentos que pongan de manifiesto el perjuicio que provocaría esta desaparición. (Desaparición de: productores de ecosistemas acuáticos, descomponedores, flora normal o habitual del cuerpo humano, flora gastro-intestinal de rumiantes, además no podrían obtenerse algunos productos elaborados industrialmente, etc.)

  7. Explique el Ciclo Lisogénico de un bacteriófago realizando dibujos de cada una de las etapas.

  8. De los virus se dice que son parásitos obligados. Exponga una explicación razonada de ello. (carencia de metabolismo propio, utilización de la maquinaria biosintética del hospedador y producción de daños)

  9. Realice una clasificación de los principales grupos de microorganismos indicando claramente los criterios utilizados para ello (formas acelulares: virus, viroides y priones; formas celulares: organización procariota (bacterias) y organización eucariota (algas, hongos y protozoos). Exponga las principales características que nos permiten distinguir a los diferentes grupos (Virus: un solo tipo de ácido nucleico; Bacterias: unicelulares y división por bipartición; Algas: unicelulares/pluricelulares y fotosintéticas; Hongos: unicelulares/pluricelulares con nutrición por absorción y heterótrofos; Protozoos: unicelulares y heterótrofos).

  10. Al realizar el cariotipo de una persona se observó que uno de los cromosomas de la pareja 8 había intercambiado un brazo con otro de la pareja 14. ¿Qué consecuencias podría tener este hecho? (se debe relacionar este hecho con la aparición de enfermedades) ¿Será esta característica transmisible a la descendencia? (se puede razonar de diversas formas: sí, si los gametos contienen la mutación; no, si la mutación altera el apareamiento de cromosomas homólogos en la meiosis).

  11. A la vista de la imagen, conteste a las siguientes preguntas:

  1. ¿Qué microorganismo representa la imagen? (un bacteriofago) ¿Cuál es su composición química? (ácido nucleico, ADN, y proteínas) (Nombre las estructuras señaladas con las letras A (cápsida: contiene el material genético), B (Vaina o Cola contráctil: inyección del material genético), C (fibras de la cola: colaboración en la adhesión) y D (Placa basal: fijación a la célula hospedadora), e indique la función que realizan.

  2. Describa brevemente el ciclo de reproducción de este microorganismo (Entrada en la célula hospedadora (adsorción y penetración), replicación y síntesis de los componentes virales, maduración y liberación, describiendo brevemente los acontecimientos principales que tienen lugar en cada una de ellas (no es imprescindible nombrar las diferentes fases)

  1. Exponga tres diferencias que distingan a los virus del resto de microorganismos (Diferencias: genoma de ARN en algunos, presencia de uno pero nunca de dos tipos de ácidos nucleicos, carencia de metabolismo propio, estructura no celular). Describa el ciclo lítico de un bacteriófago. (descripción de las fases de fijación, penetración, síntesis, ensamblaje y liberación, aunque no es imprescindible nombrar las fases)

  2. Describa las características de virus, viroides y priones, indicando los organismos a los que pueden infectar. (Virus: carácter acelular, estructura y composición química, pueden infectar a bacterias, animales y plantas; Viroides: ARN monocatenario e infectan sólo a plantas; Priones: proteínas que modifican la estructura de otras proteínas e infectan sólo a animales)

  3. (Raz) Los ribosomas de una célula infectada por un virus son capaces de sintetizar las proteínas de la cubierta del virus (capsómeros). ¿Por qué? Razone la respuesta (El virus da lugar a ácidos ribonucleicos mensajeros que pueden ser traducidos por los ribosomas de la bacteria sintetizando las proteínas víricas. Esto ocurre porque el código genético es el mismo para virus y bacterias)

  4. Describa la organización estructural de un bacteriófago y de la célula a la que infecta. (Debe quedar clara la diferencia entre la parte proteica del virus y su ácido nucleico (ADN, así como la estructura típica de cabeza, cuello, cola y placa basal. En cuanto a la bacteria: hay que describir la pared celular, la membrana plasmática, el cromosoma bacteriano y los ribosomas, por lo menos)

  5. (Raz) Suponga que existe un antibiótico, llamado “ribosomicina”, que inhibe la síntesis de proteínas porque impide la actividad de los ribosomas 70S. Dado que las bacterias tienen este tipo de ribosomas, ¿se podría utilizar la ribosomicina para combatir infecciones bacterianas en los seres humanos? (los ribosomas 70S también están presentes en las mitocondrias de las células eucarióticas,por lo tanto, no es aconsejable la utilización de ribosomicina ya que podría producirse la paralización de las funciones mitocondriales) ¿Sería recomendable este antibiótico en el caso de una infección vírica? (La respuesta a esta pregunta debe ir en la misma dirección, abundando en el hecho de que los virus no tienen ribosomas y, por lo tanto, aún en el caso de que el antibiótico no afectase a las mitocondrias, no tendría ninguna utilidad frente al virus) Razone las respuestas.

  6. A la vista de la siguiente figura que representa un tipo de microorganismo que provoca diversas enfermedades, conteste las siguientes preguntas:

  1. ¿De qué tipo de microorganismo se trata? (virus) Nombre las estructuras señaladas con las letras (A- glucoproteína; B-envoltura; C-cápsida; D-ácidos nucleico). Indique dos características que sean específicas de este tipo de microorganismo. (Carecen de organización celular, no tienen metabolismo propio, deben aprovechar los recursos de la célula hospedadora para replicarse, etc.)

  2. Indique la función de la estructura señalada con la letra A (participa en la fijación del virus a la célula), y la composición química y la función de las estructuras señaladas con las letras C (proteica, protege al ácido nucleico) y D (ARN o ADN, porta la información genética). Cite dos ejemplos de enfermedades producidas por este tipo de microorganismo (gripe, sarampión, etc.).

  1. Una determinada molécula de ADN de cadena doble presenta un 30% de adenina. ¿Cuáles serán los porcentajes de timina, guanina y citosina? ¿Cuál será el porcentaje conjunto de bases púricas? ¿Cuál será el porcentaje conjunto de las bases pirimidínicas? Indique qué valor tomará la relación bases púricas/bases pirimidínicas en dicha molécula. Razone las respuestas. (Timina 30%, guanina 20%, citosina 20%. Bases púricas 50%. Bases pirimidínicas 50%. Bases púricas/bases pirimidínicas=1)

  2. (Raz) En el ganado vacuno la ausencia de cuernos (H) es dominante sobre la presencia de cuernos (h). Un toro sin cuernos se cruzó con dos vacas. Con la vaca A, que tenía cuernos, tuvo un ternero sin cuernos; con la vaca B, que no tenía cuernos, tuvo un ternero con cuernos. ¿Cuáles son los genotipos del toro y de las vacas A y B? (El toro es heterocigótico (Hh), la vaca A es homocigótica recesiva (hh) y la vaca B heterocigótica (Hh)) Indique las proporciones de los genotipos y fenotipos que cabría esperar en la descendencia de los dos cruzamientos. (Toro Hh x vaca A hh: 50% Hh (sin cuernos) y 50% hh (con cuernos) / Toro Hh x vaca B Hh: 25% HH (sin cuernos), 50% Hh (sin cuernos) y 25% hh (con cuernos))

  3. ¿Por qué las bacterias que se encuentran en nuestro cuerpo (intestino, piel, etc.), y que en condiciones normales son beneficiosas, pueden en determinadas circunstancias producirnos enfermedades? Razone la respuesta. (Si se produce una depresión del sistema inmunitario disminuyen las defensas del organismo y los microorganismos pueden crecer descontroladamente y ocasionar enfermedades)

  4. El material genético de los virus de ADN está formado por una sola cadena de nucleótidos o por dos. Si el análisis cuantitativo del ADN de un virus demuestra que tiene un 40% de G y un 30% de A, ¿puede afirmarse que se trata de un ADN monocatenario? (Sí puede afirmarse que se trata de un ADN monocatenario ya que en un ADN de doble cadena, la suma de G y A no puede superar el 50%. Si, por ejemplo, G = 40%, significa que C = 40% y que, por tanto, la suma A + T no puede exceder del 20%, lo que en este caso no es cierto porque se indica que A representa un 30%). Razone la respuesta.

INMUNOLOGÍA

  1. Señale al menos tres características que permitan diferenciar la inmunidad adquirida (adaptativa) de la inmunidad innata.

  2. Explique qué se entiende por “memoria inmunológica” y describa el mecanismo por el que se produce.

  3. Es muy frecuente que el 80-85% de recién nacidos de madre con SIDA sean seropositivos al realizar la prueba tras el parto. Sin embargo, al repetir la prueba pasados unos meses el porcentaje de seropositivos se reduce al 20-25%. Dé una explicación razonada a este hecho. (Muchos de los recién nacidos seropositivos lo son porque tienen anticuerpos de la madre circulando por su sistema sanguíneo. A medida que los anticuerpos van desapareciendo, dejan de dar positiva la prueba y sólo permanecen como seropositivos los que verdaderamente están afectados por el virus del SIDA)

  4. A la vista del esquema responda razonadamente a las cuestiones:




no propio (antígenos)

Propio





sistema inmunitario




respuesta adquirida específica

respuesta no adquirida

inespecífica

contacto primario

+

+

contacto secundario

++++

+


Compartir con tus amigos:
  1   2


La base de datos está protegida por derechos de autor ©composi.info 2017
enviar mensaje

    Página principal