Actividades 1º bachillerato. La organización de los seres vivos el Hierro forma parte de la hemoglobina. Esta proteína, que se encuentra en los glóbulos rojos, es la encargada de transportar el o en sangre



Descargar 20.42 Kb.
Fecha de conversión26.06.2018
Tamaño20.42 Kb.

ACTIVIDADES 1º BACHILLERATO. LA ORGANIZACIÓN DE LOS SERES VIVOS

  1. El Hierro forma parte de la hemoglobina. Esta proteína, que se encuentra en los glóbulos rojos, es la encargada de transportar el O en sangre. De hecho, el O se une a la hemoglobina a través del Fe. Se sabe que el déficit de Fe provoca anemia, uno de cuyos síntomas es el cansancio o la fatiga. Investiga por qué se produce este síntoma y qué pasaría si en vez de un déficit, hubiera un exceso en el organismo.

  2. Los peces de agua dulce viven en un ambiente hipotónico y los de agua salada, en uno hipertónico. Los peces de agua dulce excretan mucha orina y , además, muy diluida. Los peces de agua salada “beben” mucha agua y su orina es escasa y muy concentrada. Explica por qué ocurre esto en cada uno de los casos.

  3. Antes de hacer deporte se aconseja tomar alimentos ricos en almidón (por ejemplo, espaguetis, macarrones o patatas), sin embargo el “combustible” utilizado por las células es preferiblemente la glucosa. ¿A qué crees que se debe este consejo?

  4. Cuando se produce un vertido de petróleo al mar, las aves que se impregnan de esa sustancia corren un grave peligro si no son tratadas a tiempo. Aparte de los efectos tóxicos producidos por los componentes del petróleo, la estructura de las plumas se rompe, de modo que pierden su capacidad de volar. Además, las plumas pierden sus propiedades impermeabilizantes. ¿Sabes por qué? ¿Qué consecuencias puede tener esto sobre las aves?

  5. Algunos animales, como los osos, almacenan durante todo el verano y el otoño grandes cantidades de energía en su organismo que consumen durante la hibernación (estado de letargo en el que pasan el invierno). De los dos tipos de moléculas que existen para almacenar energía, ¿cuál utilizarán? ¿Por qué?.

  6. Si pones un poco de leche en un vaso y añades unas gotas de limón o vinagre, observarás que se forman unos coágulos de aspecto blanquecino (lo que se denominan aspecto de leche cortada) ¿Qué crees que ha pasado?

  7. Manolo acaba de empezar a trabajar en un vivero de plantas. Su jefe le manda cuidar unos rosales que están en unas macetas. Manolo piensa que les vendría bien un abonado y para ello coger un saco de sales minerales, añade en cada maceta una cantidad de sales cinco veces superior a lo que indican las instrucciones del fabricante (pensando que es lo mejor para las plantas) y las riega. Al cabo de unos días observa horrorizado que los rosales se han secado. ¿Qué crees que ha pasado?.

  8. El alcohol es una molécula que proporciona 7 Kcal/g pero no aporta ningún nutriente beneficioso, por lo que se denominan calorías vacías. Las grasas aportan 9 Kcal/g, mientras que glúcidos y proteínas proporcionan 4 Kcal/g. Partiendo de estos datos, ¿Por qué en las dietas de adelgazamiento lo primero que se prohíbe es el alcohol? ¿Crees que sería adecuada la prohibición total de comer grasas? ¿Por qué?

  9. La etiqueta de un producto comprado en el supermercado indica la siguiente composición:

Composición nutricional por 100 g:

-Proteinas 15g

-Hidratos de carbono 58g

-Grasas 11g



¿Cuántas kilocalorías estaremos ingiriendo si tomamos 125 g de este alimento?

  1. Si pones un poco de leche en un vaso y añades unas gotas de limón o vinagre, observarás que se forman unos coágulos de aspecto blanquecino (lo que se denominan aspecto de “leche cortada”). ¿Qué crees que ha pasado?

  2. Como sabes, el ADN está formado por una doble cadena. Si las bases nitrogenadas de una de las cadenas son las siguientes ATTGGCAGTCGCGTAATGCATGC ¿Qué bases aparecerán en la otra cadena? ¿Cómo sería el RNA correspondiente a la cadena inicial? ¿Qué aminoácidos para la formación de proteínas codificaría?. Ayúdate de un código genético que puedes encontrar en internet o en un libro de 4º de ESO.

  3. Observa los siguientes compuestos. Indica a qué tipo de biomolécula corresponden y por qué lo sabes.

































  1. Clasifica los glúcidos realizando un pequeño esquema y poniendo ejemplos.

  2. Haz un cuadro esquemático en el que aparezcan los orgánulos celulares, tanto animales como vegetales, en donde aparezca el nombre, la función y la descripción del orgánulo.

  3. Rellena el siguiente dibujo






  1. Entre en el proyecto biosfera. 1º de bachillerato y realiza la actividad 4,11, 12 y 13 del tema de las formas de organización de la vida.


Compartir con tus amigos:


La base de datos está protegida por derechos de autor ©composi.info 2017
enviar mensaje

    Página principal